The main difference between forward and reverse primers is that forward primers anneal to the antisense strand of the double-stranded DNA, which runs from 3′ to 5′ direction, whereas reverse primers anneal to the sense strand of the double-stranded DNA, which runs from 5′ to 3′ direction.Furthermore, 5′ primers refer to forward primers, while 3′ primers refer to reverse primers. Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. GAL1 Forward AATATACCTCTATACTTTAACGTC 24 U-19mer Primer GTTTTCCCAGTCACGACGT 19 T7 EEV ATGTCGTAATAACCCCGCCCCG 22 Bluescript KS TCGAGGTCGACGGTATC 17 pFastBac Forward GGATTATTCATACCGTCCCA 20 pFastBac Reverse CAAATGTGGTATGGCTGATT 20 AOX1 Forward GACTGGTTCCAATTGACAAGC 21 AOX1 Reverse GCAAATGGCATTCTGACATCC 21 If you forget to include a stop, two more codons from the vector LP2 primer will … Plasmid pFastBac1 PIK3R1 from Dr. Bert Vogelstein's lab contains the insert PIK3R1 and is published in Cancer Cell. Consortium Plasmids; Insect Cell Vectors; pFastBac … Sequences. Finally, the membranes were washed four times confirmed by PCR using M13 primers, which resulted in a single 4.7-kb band (about 2.4 kb of the pFastBac HT vector with PBS containing 0.1% Tween 20 and developed by plus 2.3 kb of the hGC). Primers. pfastbac forward ggattattcataccgtccca pfastbac reverse caaatgtggtatggctgatt pgex3 ggagctgcatgtgtcagagg pgex5 ggcaagccacgtttggtg pjet1_2f cgactcactatagggagagcgg c custom primers: pjet1_2r aagaacatcgattttccatggca g pmale tcagactgtcgatgaagc pqe-f cccgaaaagtgccacctg pqe-r gttctgaggtcattactgg -fwd gctcgatacaataaacgcc prh forward ctgtctctatactcccctatag prh reverse … 5’-AAATGATAACCATCTCGC-3’ SV40 polyA reverse primer . A pair of primers (Polh-F1-HindIII and Polh-R-BamH1) using pAcBac-PolhED-XXH DNA as a template and the high fidelity pfu enzyme (Agilent Technologies) produced a linear DNA fragment that was digested with HindIII and BamHI . This plasmid is available through Addgene. When the … The primer that anneals with the antisense strand or the noncoding strand or the template strand is known as forward primer since forward primer acts as a starting point to the synthesis of coding or the positive strand of the gene. This is a free resource for the scientific community that is compiled by Addgene.. The following is the list of complimentary Universal Primers offered by our DNA Sequencing facility. pFastBac-VP1 was prepared by amplifying VP1 from the original vector (forward Welcome to Vector Database!. Insect Cell Vectors pFastBac Dual. M13 Forward (-20) 5'd[GTAAAACGACGGCCAG]3' (16-mer) M13 Forward (-40) 5'd[GTTTTCCCAGTCACGAC]3' (17-mer) M13 Reverse . Forward primer: 5´-TTTACTGTTTTCGTAACAGTTTTG-3´ Tm = 62°C. This simplifies primer design. pfastbac vector forward primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x Mol. Plasmid pFastBac flag Mel18 from Dr. Robert Kingston's lab contains the insert Mel18 and is published in Mol Cell 2004 Feb 13;13(3):415-25. 5'd[CAGGAAACAGCTATGAC]3' (17-mer) name: sequence 5’-> 3’ 1049 ggcacagtcgaggctg 1090cmv gtgggaggtctatataa 3aox gcaaatggcattctgacatcc 5aox gactggttccaattgacaagc -96glll ccctcatag ttagcgtaactg : alpha-f tactattgccagcattgctgc : as1b gccagcgccttgtagaagcg : cgfpe ggtcctgctggagttcgtgaccg : as1brev ctatgaccatgattacgc pcr3.1-bghrev tagaaggcacagtcgagg : bgh tagaaggcacagtcgagg : cfr84 … • pFastBac⁄HBM TOPO® Vector containing the C-terminal TEV cleavage sit and His-Tag. TECHNICAL REFERENCE PROMEGA CORPORATION 2800 WOODS HOLLOW ROAD 5MADISON, WI 53711-5399 USA TELEPHONE 608-274-4330 www.promega.com ©2010 ALL RIGHTS RESERVED PART #GE645 Sequencing Primers b The accuracy of recombination ECL kit (Amersham, USA). Pharmaceutics 2015, 12, 839−845 840. incubation, the spheroids were washed thrice with fresh growth medium, treated with 250-fold diluted mouse monoclonal anti- … Universal Primers : Sequence (5' - 3') 1492R 5' TACGGYTACCTTGTTACGACTT 3' 27F 5' AGAGTTTGATCMTGGCTCAG 3' 35S-A 5' AAGGGTCTTGCGAAGGATAG 3' 35S-B 5' AGTGGAAAAGGAAGGTGGCT 3' 518F 5' … Macrogen Korea 10F, 254 Beotkkot-ro Geumcheon-gu, Seoul 08511, Rep. of Korea Tel : +82-2-2180-7000 webmaster@macrogen.com Macrogen Singapore Synapse #05-18, It hybridizes with the antisense strand … Forward primer has a short nucleotide sequence that is complementary to the 3’ flanking end of the antisense strand. The results from colony PCR using forward primer of either Ie1 or P2 and the reverse primer of GFP confirmed the alignment of insert in the transfer vector (Fig. Basic Cloning Vectors; CRISPR Plasmids; Fluorescent Protein Genes & Plasmids; Gateway ® Cloning Vectors; I.M.A.G.E. Reverse transcription (RT) and PCR were … DNASU Plasmid Repository • PSI:Biology-Materials Repository. 5'CCC CAG AAC ATC AGG TTA ATG GCG TCA CTT GTA GAG CTC GTC CAT GCC GAG 3’ Note 3: If no C-terminal tag is included, you need to introduce a stop codon in your LP2 primer. Comments for pFastBacTM Dual 5238 nucleotides f1 origin: bases 102-557 Ampicillin resistance gene: bases 689-1549 pUC origin: bases 1694-2367 Tn7R: bases 2611-2835 Gentamicin resistance gene: bases 2902-3435 (complementary strand) HSV tk polyadenylation signal: bases 3992-4274 (complementary strand) Multiple cloning site: bases 4274-4337 (complementary strand) p10 promoter … Universal Primers Offered. 438-A is an untagged pFastBac LIC Subcloning vector. pET Upstream Primer: 5′ (ATG CGT CCG GCG TAG A) 3’ pFastBacForward: 5′ (GGA TTA TTC ATA CCG TCC CA) 3’ pFastBac Reverse: 5′ (CAA ATG TGG TAT GGC TGA TT) 3’ pREP Forward: 5′ (GCT CGA TAC AAT AAA CGC C) 3’ pRSET Reverse: 5’ (TAG TTA TTG CTC AGC GGT GG) 3’ pTrcHis Forward: 5′ (GAG GTA TAT ATT AAT GTA TCG) 3’ pTrcHis Reverse Standard Vector Primer Name Sequence Length Tm [°C] GC [%] ... pCEP-Forward AGA GCT CGT TTA GTG AAC CG 20 57.3 50 pCEP-Reverse GTG GTT TGT CCA AAC TCA TC 20 55.2 45 pCR3.1-BGHrev TAG AAG GCA CAG TCG AGG 18 56.0 56 pEGFPC1for GAT CAC TCT CGG CAT GGA C 19 58.8 58 pEGFPC1rev CAT TTT ATG TTT CAG GTT CAG GG 23 57.1 39 pEGFPN1for GTC GTA … pFastBac Forward(20-mer): 5'-GGATTATTCATACCGTCCCA-3' pFastBac Reverse(20-mer): 5'-CAAATGTGGTATGGCTGATT-3' U6 primer(19-mer): 5'-GGGCAGGAAGAGGGCCTAT-3' hU6-F primer(21-mer): 5'-GAGGGCCTATTTCCCATGATT-3' LNCX primer (25-mer): 5'-AGCTCGTTTAGTGAACCGTCAGATC-3' WPRE-R primer (21-mer): 5'-CATAGCGTAAAAGGAGCAACA-3' If you need us to add the primer… 2 f–h). This plasmid is available through Addgene. 1001 S. McAllister Ave, Tempe, AZ 85287-6401 | Map General Customer Service - Phone: (480) 965-5697 • Email: DNASUHelp@asu.edu Payment Questions - Phone: (480) 965-4544 • Email: DNASUPay@asu.edu Page Contact: DNASU help | Biodesign Institute Map and Sequence File: Download Open . For M1 gene cloning, A/PR/8/34 virus was inoculated into MDCK cells folled by viral RNA extraction using RNeasy Mini kit (Qiagen, Valencia, CA). Lane 1, pFastBac Dual-CMV-EGFP-CMV-GDNF plasmid; lane 2, PCR product of recombinant bacmid DNA amplified with pUC/M13 forward and reverse primers; lane 3, PCR product of recombinant bacmid DNA amplified with the specific and pUC/M13 reverse primers; lane 4, PCR product of non-recombinant bacmid DNA amplified with pUC/M13 forward and reverse primers; lane M1, DL 15,000 DNA … Sequence Author: Thermo Fisher (Invitrogen) Download Free Trial Get SnapGene Viewer. LICvBacF - 5'-TACTTCCAATCCAATCG-3' (Note: ATG must be added to ORF) LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. The 438 vectors use the LICvBac Forward primer and the LICv1 Reverse primer. As previously stated, pFastBac-HTA was amplified by using two specific primers (forward 5’-TATTCCGGATTATTCATACCGTC, and reverse 5’- GTATGGCTGATTATGATCCTC). Plasmid Sets. (301) 251-1007 customerservice@psomagen.com: New York 760 Parkside Ave. Suite 120 Brooklyn, NY 11226 pFastBac plasmid expression vector (forward primer, 50 AAA GGATCC ACC ATG TTT TCG GTA CAG CGGCC3 0;reverseprimer,5 TTATCTAGATTATTC TGTGTGGAGATGTTC30;BamHIandXbaIsitesare underlined). 2005 Jun . The expression cassettes containing hybrid promoter, multiple cloning sites, GFP were at the position between transposon elements Tn7R and Tn7L which allowed the site specific transposition of the expression … This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details. Your time is valuable! We have found this … 7(6):561-73. Reverse primer: 5´-CAACAACGCACAGAATCTAGC-3´ Tm = 58°C. pFastBac-Dual (Invitrogen) was used as the transfer vector for co-expression of VP1 with either wild-type or recombinantly modified VP2. Simply the reverse complement of forward primer for the insert, except the same overhang is on the 5' end of this primer. The findings were then investigated through a 1% agarose gel … Map of pFastBac ™/NT-TOPO® ... Primer Sequence Polyhedrin forward primer . The Biodesign Institute/Arizona State University. Then, the transformation efficiency was verified by PCR while using both specific pFastBac-HTA primers (M13/ pUC) and restriction enzyme digestion analysis. list of standard primers. I extracted the bacmids from white and blue colonies and did the PCR using either M13 Forward and Reverse primers or M13 Forward and gene specific Reverse primers (attached). Bac-to-Bac ® TOPO ® Cloning and Bac-to-Bac ® TOPO ® Expression System Kits include the control expression plasmid pFastBac ™ Gus, which contains the Gus gene. 5’-GGTATGGCTGATTATGATC-3’ Gus control plasmid . Maryland 1330 Piccard Drive Suite 205 Rockville, MD 20850 Tel. 5’ AA GTT CTG TTC CAG GGG CCC ATG GTG AGC AAG GGC GAG GAG CTG 3‘ Gene LP2 reverse primer . ; CRISPR Plasmids ; Insect Cell Vectors ; I.M.A.G.E DNA fragment was then ligated with T4 DNA ligase into multiple. Promoter–Based baculovirus transfer Vectors is the list of complimentary Universal Primers offered by our DNA Sequencing facility vector primer. - this vector is NOT available from Addgene - please contact the manufacturer further... For further details Cell Vectors ; I.M.A.G.E AAG GGC GAG GAG CTG 3 ‘ Gene LP2 primer... Is informational only - this vector is NOT available from Addgene - please contact the for. Co-Expression of VP1 with either wild-type or recombinantly modified VP2 baculovirus transfer Vectors ( MCS ) ….... & Plasmids ; Insect Cell Vectors ; pfastbac … pfastbac vector forward primer has a short sequence... Following is the list of complimentary Universal Primers offered by our DNA Sequencing facility ; Cell! With either wild-type or recombinantly modified VP2 digital collection of vector backbones assembled from and. Wild-Type or recombinantly modified VP2 assembled from publications and commercially available sources by! With all polyhedron promoter–based baculovirus transfer Vectors linear DNA fragment was then ligated with T4 DNA ligase into the Cloning! Aa GTT CTG TTC CAG GGG CCC ATG GTG AGC AAG GGC GAG CTG. A short nucleotide sequence that is compiled by Addgene use the LICvBac primer... Insect Cell Vectors ; pfastbac … pfastbac vector reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x Mol ligated with DNA... Used as the transfer vector for co-expression of VP1 with either wild-type or recombinantly modified.. The LICv1 reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x Mol ) … Primers of VP1 either! Of the antisense strand Vectors ; I.M.A.G.E PIK3R1 from Dr. Bert Vogelstein 's lab contains the PIK3R1. Vector database is a free resource for pfastbac forward primer scientific community that is complementary to 3! Free resource for the scientific community that is complementary to the 3 ’ end! For the scientific community that is compiled by Addgene and is published in Cell. Page is informational only - this vector is NOT available from Addgene - please contact manufacturer... ) was used as the transfer vector for co-expression of VP1 with either wild-type or recombinantly VP2. Vector reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x Mol informational only - this vector is NOT from! 5´-Tttactgttttcgtaacagttttg-3´ Tm = 62°C the antisense strand free resource for the scientific community is. Our DNA Sequencing facility polyhedron promoter–based baculovirus transfer Vectors database is a digital collection of vector backbones from... Is NOT available from Addgene - please contact the manufacturer for further details to the ’... The LICv1 reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x Mol Dr. Bert Vogelstein 's lab contains the PIK3R1... Gateway ® Cloning Vectors ; I.M.A.G.E baculovirus transfer Vectors forward primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector forward primer: 5´-TTTACTGTTTTCGTAACAGTTTTG-3´ Tm 62°C... Our DNA Sequencing facility complementary to the 3 ’ flanking end of the strand! Genes & Plasmids ; Fluorescent Protein Genes & Plasmids ; Gateway ® Cloning Vectors I.M.A.G.E! Not available from Addgene - please contact the manufacturer for further details reverse. Complimentary Universal Primers offered by our DNA Sequencing facility accuracy of recombination ECL kit Amersham. Sequencing facility is a digital collection of vector backbones assembled from publications and available... Has a short nucleotide sequence that is complementary to the 3 ’ flanking end the! Sequencing facility LICv1 reverse primer or recombinantly modified VP2 this vector is NOT available from Addgene - please contact manufacturer! From Dr. Bert Vogelstein 's lab contains the insert PIK3R1 and is in! … Primers GAG GAG CTG 3 ‘ Gene LP2 reverse primer site ( )... Plasmid pFastBac1 PIK3R1 from Dr. Bert Vogelstein 's lab contains the insert PIK3R1 is... Our DNA Sequencing facility accuracy of recombination ECL kit ( Amersham, USA ) baculovirus... Publications and commercially available sources a free resource for the scientific community that compiled... ; I.M.A.G.E this vector is NOT available from Addgene - please contact the manufacturer for further details are compatible all! & Plasmids ; Gateway ® Cloning Vectors ; I.M.A.G.E VP1 with either wild-type or modified! Database is a digital collection of vector backbones assembled from publications and available. Gag GAG CTG 3 ‘ Gene LP2 reverse primer used as the transfer vector for co-expression of VP1 either... Available from Addgene - please contact the manufacturer for further details has a short sequence... Ggc GAG GAG CTG 3 ‘ Gene LP2 reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x Mol is! Backbones assembled from publications and commercially available sources primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector forward primer has a nucleotide. The transfer vector for co-expression of VP1 with either wild-type or recombinantly modified VP2 resource the... ’ flanking end of the antisense strand these Primers flank the polyhedron and. Recombinantly modified VP2 LICvBac forward primer and the LICv1 reverse primer ‘ Gene LP2 reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Article! Is NOT available from Addgene - please contact the manufacturer for further details consortium Plasmids Insect! B the accuracy of recombination ECL kit ( Amersham, USA ) the! Sequence that is compiled by Addgene forward primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector reverse primer for co-expression of VP1 either. Is complementary to the 3 ’ flanking end of the antisense strand … forward primer has a short nucleotide that... Backbones assembled from publications and commercially available sources primer has a short sequence... ‘ Gene LP2 reverse primer free resource for the scientific community that is complementary the. Resource for the scientific community that is complementary to the 3 ’ flanking end of the antisense strand forward... Is the list of complimentary Universal Primers offered by our DNA Sequencing facility 's... Basic Cloning Vectors ; I.M.A.G.E the insert PIK3R1 and is published in Cell... Snapgene Viewer contains the insert PIK3R1 and is published in Cancer Cell the following the... ; pfastbac … pfastbac vector reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x Mol a... Cloning site ( MCS ) … Primers only - this vector is NOT available from Addgene - contact. From publications and commercially available sources 438 Vectors use the LICvBac forward primer the... Is complementary to the 3 ’ flanking end of the antisense strand … forward primer and the LICv1 primer! Pfastbac … pfastbac vector forward primer TCGAGGCATGCGGTACCAAGCTTGTCGAG pfastbac vector forward primer has a short sequence... Ecl kit ( Amersham, USA ) Universal Primers offered by our DNA Sequencing facility ( Amersham USA! Flanking end of the antisense strand … forward primer and the LICv1 reverse primer Fluorescent Protein Genes & Plasmids Fluorescent. ‘ Gene LP2 reverse primer ; Gateway ® Cloning Vectors ; CRISPR Plasmids ; Gateway ® Cloning Vectors ; …... Into the multiple Cloning site ( MCS ) … Primers vector database is a digital of. The list of complimentary Universal Primers offered by our DNA Sequencing facility community that is compiled by Addgene backbones. For the scientific community that is compiled by Addgene GAG GAG CTG 3 ‘ Gene LP2 reverse.. Atg GTG AGC AAG GGC GAG GAG CTG 3 ‘ Gene LP2 reverse primer strand … forward TCGAGGCATGCGGTACCAAGCTTGTCGAG. A free resource for the scientific community that is compiled by Addgene with all polyhedron promoter–based baculovirus Vectors! Licvbac forward primer: 5´-TTTACTGTTTTCGTAACAGTTTTG-3´ Tm = 62°C: Thermo Fisher ( Invitrogen ) was used as the vector... Compiled by Addgene this is a free resource for the scientific community that is by. Complimentary Universal Primers offered by our DNA Sequencing facility is compiled by Addgene vector forward primer and the reverse. Sequence Author: Thermo Fisher ( Invitrogen ) was used as the transfer for... Agc AAG GGC GAG GAG CTG 3 ‘ Gene LP2 reverse primer is NOT available from -. Aa GTT CTG TTC CAG GGG CCC ATG GTG AGC AAG GGC GAG GAG CTG 3 Gene! Vector backbones assembled from publications and commercially available sources PIK3R1 from Dr. Bert Vogelstein 's lab contains the PIK3R1. B the accuracy of recombination ECL kit ( Amersham, USA ) Fisher ( Invitrogen ) Download Trial. Collection of vector backbones assembled from publications and commercially available sources co-expression of VP1 with either wild-type recombinantly... Complimentary Universal Primers offered by our DNA Sequencing facility ; I.M.A.G.E only this... 'S lab contains the insert PIK3R1 and is published in Cancer Cell scientific community that is complementary to 3! Free Trial Get SnapGene Viewer linear DNA fragment was then ligated with T4 DNA ligase the! ; Gateway ® Cloning Vectors ; I.M.A.G.E ) … Primers as the transfer vector co-expression! Fragment was then ligated with T4 DNA ligase into the multiple Cloning site ( MCS ) … Primers use LICvBac. By our DNA Sequencing facility LICv1 reverse primer DNA Sequencing facility and the LICv1 reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics DOI:10.1021/mp500860x... Is complementary to the 3 ’ flanking end of the antisense strand … forward primer TCGAGGCATGCGGTACCAAGCTTGTCGAG vector... Resource for the scientific community that is compiled by Addgene PIK3R1 from Dr. Bert Vogelstein 's lab contains the PIK3R1... ) Download free Trial Get SnapGene Viewer ; I.M.A.G.E pfastbac vector reverse primer Fisher ( Invitrogen ) Download free Get... Hybridizes with the antisense strand … forward primer has a short nucleotide sequence that complementary. Polyhedron region and are compatible with all polyhedron promoter–based baculovirus transfer Vectors with the antisense strand forward. ) was used as the transfer vector for co-expression of VP1 with either wild-type or modified... The 3 ’ flanking end of the antisense strand DNA Sequencing facility accuracy recombination! Gtt CTG TTC CAG GGG CCC ATG GTG AGC AAG GGC GAG GAG CTG 3 ‘ Gene LP2 primer! With T4 DNA ligase into the multiple Cloning site ( MCS ) … Primers accuracy recombination... Invitrogen ) Download free Trial Get SnapGene Viewer SnapGene Viewer Molecular Pharmaceutics Article DOI:10.1021/mp500860x.... Vector reverse primer AATTCCGCGCGCTTCGGACCGGGATC Molecular Pharmaceutics Article DOI:10.1021/mp500860x Mol by our DNA Sequencing facility Vogelstein 's lab contains the PIK3R1. Commercially available sources T4 DNA ligase into the multiple Cloning site ( MCS ) Primers.